Exiqon
Home Search Contact Print
0 items in basket0
Sign In
 
 
Products Services Applications Resource Center Ordering About Exiqon
microRNA Research
lncRNA Research
mRNA Research
DNA Research
Custom Oligos
Other Reagents
RNA Isolation
Sequencing
Microarray Analysis
Real-time PCR
Northern Blotting
In Situ Hybridization
Functional Analysis
RNA Preparation
Sequencing
Microarray analysis
Real-time PCR
In Situ Hybridization
Antisense
RNA Preparation
Sequencing
Microarray analysis
Real-time PCR
In Situ Hybridization
Antisense
SNP Detection
Sequencing
Microarray Analysis
In Situ Hybridization
LNA Phosphoramidites
A2 Quencher
RNA Isolation Services
microRNA PCR Services
Sequencing Services
XploreRNA
microRNA ISH Services
Custom Pharma Service
Isolation
Microarray Analysis
Northern Blotting
Real-time PCR
In Situ Hybridization
Functional Analysis
SNP Detection
RNA
microRNA
RNA
DNA
microRNA
microRNA
RNA
microRNA
RNA
DNA
microRNA
RNA
DNA
microRNA Resources
mRNA and lncRNA Resources
Documents
Reading rooms
Application Stories
Technology
Oligo design tools
Movies
microRNA
Research Guide
Reading rooms
Application Stories
Bioinformatics and data analysis
What are lncRNAs?
Application Stories
Bioinformatics
Oligo modifications
LNA™
AQ-link
Order microRNA products
Order custom oligos
Distributors
Global Service Providers
General Information
Contact
News
History
Management
Board of Directors
Newsletter
Career
Sign up to Newsletter
Newsletter Back Issues
 

microRNA Inhibitors and Power Inhibitors

Reverse genetics with antisense inhibitors is one of the most powerful ways of understanding microRNA function. We have exploited our LNA™ technology even further to develop 3rd generation inhibitors that are truly unique in terms of potency, specificity and stability.

Silence microRNAs without transfection reagents

Efficient inhibition of microRNA activity can be achieved by simple addition of LNA™ microRNA Power Inhibitor directly to cell culture medium. This allows you to study cellular phenotypes without worrying about confounding side effects deriving from the transfection reagents.

Learn more
  • Tm normalized inhibitors with unmatched potency against all microRNA regardless of GC content
  • Power inhibitors so potent that they work by unassisted uptake without the need for transfection reagents
  • Superior specificity and biological stability for long lasting antisense activity
  • Available in 1 nmol, 5 nmol and 15 nmol quantities
  • Available with flourescent labels for convenient monitoring of transfection efficiency

Coverage and Content

Pre-designed miRCURY LNA™ microRNA Inhibitors and Power Inhibitors have been designed for all known microRNAs in human, mouse and rat. Since many microRNAs are phylogenetically conserved, this set of microRNA inhibitors cover a large proportion of microRNAs in vertebrates and invertebrates.

The miRCURY LNA™ microRNA Inhibitors are also available with fluorescein (6-FAM) labels. All microRNA inhibitors are desalted and delivered dried down in tubes. Once dissolved they are ready for transfection or electroporation using standard techniques

A choice of three different product categories is offered in three different amounts (1 nmol, 5 nmol and 15 nmol):

  • miRCURY LNA™ microRNA Inhibitors Pre-designed LNA™-enhanced microRNA inhibitors. These DNA/LNA™ mixmer antisense oligonucleotides have normal phosphodiester nucleotide bonds.
  • miRCURY LNA™ microRNA Power Inhibitors Power inhibitors have a fully phosphorothioate (PS) modified backbone which makes them highly resistant to enzymatic degradation. As a result they have superior potency and greatly increased stability. In fact efficient inhibition of microRNA activity can be achieved by simple addition of Power inhibitors directly to cell cultures. This allows you to study the consequences of microRNA silencing without worrying about confounding side effects deriving from the transfection reagents. In all other respects this class of inhibitors is identical to our regular line of microRNA inhibitors.
  • Custom miRCURY LNA™ microRNA Inhibitors If your choice of microRNA inhibitor is not available among the pre-desigend products, Exiqon will design it for you. Read more at Custom miRCURY LNA™ microRNA Inhibitors

 

 

Design

The sequences of the microRNA inhibitors and their LNA™ spiking patterns have been carefully designed to ensure Tm normalization around an optimal temperature. As a result our inhibitors have uniform high potency regardless of the GC content of their microRNA targets.

The miRCURY LNA™ microRNA Power Inhibitors have phosphorothioate (PS) modified backbones that dramatically improve their biological stability. We therefore recommend these inhibitors in difficult applications where:
  • the transfection efficiency is limiting (primary cells, cells growing in suspension)
  • the microRNA target is highly expressed
  • the phenotypic readout takes place >72 h after transfection (cell differentiation)
  • regular microRNA inhibitors fail
Note: Power Inhibitors are not recommended for use with cells or cell lines derived from muscle or the central nervous system (CNS). These cell types are known to be particularly sensitive to sequence-dependent toxicity of phosphorothioate-modified oligonucleotides.


Application

Our miRCURY LNA™ microRNA Inhibitors are ideal for use as specific suppressors of microRNA activity. Observing the effects of miRNA inhibition is an effect approach for the study of microRNA function in cellular processes and pathological pathways and microRNA regulation of gene expression including identification and validation of specific microRNA targets.

 

Note

miRCURY LNA™ microRNA Inhibitor Negative Controls are also available.

To find a particular miRCURY LNA™ microRNA Inhibitor, please use the search function below.

Unmatched high and uniform potency

The potency of microRNA antisense inhibitors is determined by their affinity for their microRNA target and their biological stability. The GC-content of microRNAs varies between 5% - 95%. With conventional nucleotide chemistry the affinity of inhibitors is basically a function of the microRNA targets GC content and as a result the potencies of such inhibitors will vary greately according to the microRNA sequence and efficient KD is not achievable with AT- rich microRNAs.

We have exploited the high affinity properties of LNA™ chemistry to create T m normalized miRCURY LNA™ microRNA Inhibitors. By varying the number and positions of LNA™ nucleotides in our DNA/LNA™ mixmer inhibitors and careful choice of their target sequence (our inhibitors are not full length), the melting temperatures of the oligonucleotides have been normalized within a narrow window around an empirically determined optimal high temperature see Figure 1.

These design features ensure that miRCURY LNA™ microRNA Inhibitors have the same high efficacy regardless of the GC-content of their microRNA target.


Use Power inhibitors to achieve microRNA silencing without transfection reagents

The miRCURY LNA™ microRNA Power Inhibitors come with a fully phosphorothioate (PS) modified backbone, which dramatically improves their stability against enzymatic degradation. As seen in Figure 3, the efficacy of these inhibitors is significantly better compared to our regular inhibitors. In addition they are so stable and potent that they can be added directly to the culture medium without the need for transfection reagents. Efficient microRNA inhibition can be achieved by such unassisted “naked” delivery – also known as “gymnosis”. However higher concentrations are required and the uptake kinetics are slower that when using transfection reagents – see figure 4. Power inhibitors are therefore especially useful for difficult applications – i.e. hard-to-transfect cells, highly expressed microRNA target, long duration experiments and when normal transfection procedures (addition of transfection reagents or electroporation) have unacceptable phenotypic consequences.

Excellent specificity

Intelligent LNA™-spiking also ensures excellent discrimination between closely related microRNA family members, which means that any biological effects seen with the inhibitors can be safely attributed to the antisense inhibition of the targeted microRNA and not to unspecific binding.

Minimal toxicity and off-target effects

Because of the high potency of both miRCURY LNA™ microRNA Inhibitors and Power Inhibitors they can be used at low concentrations minimizing risk of undesired secondary effects unrelated to the antisense activity.

DNA/RNA duplexes are a substrate for RNase H that will cause degradation of the RNA strand. We utilize this catalytic activity in our gapmers for RNA silencing . To ensure that our microRNA inhibitors do not cause degradation of mRNA and long non-coding RNAs that happen to contain a complementary sequence we have spiked LNA such that they are never distanced by more than a few bases. Since LNA™ effectively inhibits RNase H activity this ensures that LNA™ inhibitor/RNA duplexes are not recognized as substrates by RNase H. As a consequence, there will be minimal off-target effects on mRNA and lncRNA stability. Finally ribosomes have strong helicase activity capable of effective removal of even LNA™-enhanced high affinity short oligonucleotides. So our inhibitors also have minimal effects on translation of mRNAs that have complementary sequences in the open reading frame.
Figure 1 LNA™ microRNA inhibitors have high, uniform melting temperatures
Exiqon's microRNA inhibitors have high uniform potency. (Click to learn more)



Figure 2 miRCURY LNA™ microRNA Inhibitors have high, uniform melting temperatures

Examples of microRNA silencing. (Click to learn more)



Figure 3
Power inhibitors have even higher potency
Power inhibitors offer even higher potency. (Click to learn more)



Figure 4
microRNA silencing without transfection reagents
microRNA silencing without transfection reagents. (Click to learn more)







Magali Taulan

Development of antisense therapy for cystic fibrosis


"In our hands, in addition to high affinity, LNA™ antisense oligonucleotides display excellent activity upon simple addition to the cell culture – without the need for transfection reagents – which is great advantage when working with primary cell cultures."

Dr. Magali Taulan is an associate professor at the University of Montpellier in France. Her lab has been using LNA™ antisense oligonucleotides that interfere with microRNAs to better understanding how expression of the gene (CFTR) is regulated. As a result, the study potentially identify new targets for treatment of CF.

Read full story...

Kiran Kumar Bali

microRNAs in pain


"I recommend Exiqon's miRNA inhibitors mainly because of their specificity and less off-target effects. Customer friendly handling of orders and providing useful discussions with experienced scientists is another reason for my recommendation."

Dr. Kiran Kumar Bali is a postdoc in Prof. Rohini Kuner's lab at the University Clinic Heidelberg in Germany. He has been using microRNA inhibitors in vivo to study microRNAs involved in chronic pain.

Read full story...

Virgine Mattot

MicroRNA function in endothelial cells


"Target Site Blockers are efficient tools to demonstrate the specific involvement of putative microRNA targets in the function played by this microRNA. The use of LNA™ allows the design of short oligonucleotides that are very specific and easy to work with."

Dr. Mattot studies the roles played by microRNAs in endothelial cells during physiological and pathological processes such as angiogenesis or endothelium activation. The fact that her microRNA of interest had a predicted target gene which was previously uncharacterized was a major challenge. However through the use of specific target site blockers, it was possible to demonstrate that this unknown gene was associated with the phenotype observed when the microRNA was inhibited in endothelial cells.

Read full story...

Jan-Wilhelm Kornfeld

microRNA and diabetes


"The rapid generation and delivery of LNA™ microRNA inhibitors allowed for the quick execution of in vivo experiments and offered an attractive alternative to the generation of conventional microRNA knockout models. The addition, the LNA™ inhibitors are highly effective."

Dr. Jan-Wilhelm Kornfeld works in the lab of Prof. Jens C. Brüning in the Department of Mouse Genetics and Metabolism at the University of Cologne and the Max-Planck-Institute for Neurological Research (MPI-nF). Their work using in vivo LNA™ microRNA inhibitors towards miR-802 in mice demonstrates the great future potential for oligonucleotide-based therapeutics for this complex disease.

Read full story...

Stefanie Dimmeler

MicroRNAs in heart disease


"The LNA™-inhibitors from Exiqon just work."

Stefanie Dimmeler, Professor and group leader, and Reinier Boon, Post Doctoral researcher, work in the Institute for Cardiovascular Regeneration at the Goethe University Frankfurt, Germany. Here they study the basic mechanisms underlying cardiovascular disease and vessel growth with the aim to develop new therapies to improve treatment of cardiovascular diseases.

Read full story...

David C. Henshall

MicroRNAs in epilepsy


"For us the main benefits of Exiqon’s microRNA inhibitors have been potency and high stability."

Eva M. Jimenez-Mateos and David C. Henshall work at the Centre for the Study of Neurological Disorders at the Royal College of Surgeons in Ireland. Here, they study how microRNAs influence epilepsy. A main challenge in the project was finding the optimal dose of inhibitor and scramble control to get specific inhibition and avoid off-target effects.

Read full story...

Holger Willenbring

The role of miR-21 in liver regeneration


Holger Willenbring, Associate professor and Raymond Ng, PhD student, from Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research Department of Surgery, Division of Transplantation at the University of California San Francisco study many aspects of liver regeneration. They have been using Exiqon array services and miRCURY LNA™ microRNA in vivo inhibitors to study the role of miRNAs in this process.

Read full story...

Xavier Gidrol

High content microRNA inhibitor screening with cell arrays


"...thanks to the LNA™ microRNA inhibitor screen, we have discovered several new miRNAs playing a major role in the regulation of the proliferation/differentiation balance in prostate cells."

Dr. Xavier Gidrol directs the Biomics Laboratory at the Institute of Life Science Research and Technologies in Grenoble, France. They use microfluidics, micromanufacturing and MEMS to study the impact of genetic and micro-environmental determinants on carcinogenesis, at the scale of a few or even single cells. Xavier has used minute cell microarrays to perform high throughput and high content screening with our human library of microRNA inhibitors in primary prostate cancer cells extracted from patients.

Read full story...

Amy Hansen

Viral microRNAs Involved in Cell Reprogramming


"Previously, we had tried other inhibitor designs but these gave inconclusive results."

Amy Hansen is a Ph.D student at the University College London. She works in the Cancer Research UK Viral Oncology Group lead by Professor Chris Boshoff, Director of the UCL Cancer Institute.

Read full story...

Annick Harel-Bellan

MicroRNAs and Muscle Cell Differentiation


LNA microRNA antisense inhibitors are efficient and specific with long lasting effects.

Dr. Annick Harel-Bellan (AHB) is Directeur de Recherche at the Institut Andre Lwoff in Paris. She heads a group working on epigenetics and cancer (Laboratoire Epigenetique et Cancer). Dr. Anna Polesskaya (AP) is a senior scientist and longstanding member of this group.

Read full story...



Important note regarding product searches using miRBase microRNA names:
 
MicroRNA names used in this search tool use miRBase v. 20 nomenclature. If you know the microRNA name according to more recent versions of miRBase, you can find out what the v. 20 name was by entering the name into miRSearch.
Products ready to order
Product number:
Mature miRNA miRBase ID (name)/accession (MIMAT#):
Mature miRNA sequence:

Note:
Due to cross-species conservation queries with a microRNA from a given species may give an inhibitor named for another species (typically hsa-mir-xxxx). There may be subtle differences in sequence and LNA™ spiking pattern between human, mouse and rat inhibitors for the same microRNA – even when this microRNA is perfectly conserved in the three animals. This is because the design algorithm attempts to design inhibitors with maximal specificity in each of these three genetic contexts. However for virtually all practical purposes microRNA inhibitors can safely be used across species if the microRNA target is conserved. To see all microRNAs targeted by the inhibitor click on the product and go to the “Targeted microRNAs” tab.

Search tips:
Search for the microRNA by entering:
  • product number (4104027-001)
  • mature microRNA miRBase ID (hsa-mir-21-3p)
  • mature microRNA miRBase accession (MIMAT0004494)
  • mature microRNA sequence (caacaccagucgaugggcugu)
If no results are returned please check that the entered information is accurate or entered in the correct field. In case there is no predesigned inhibitor for the desired microRNA then we can custom design it for you. Please contact our technical support.
NB: Queries with stem-loop pre-microRNA miRBase accession (MI0000077) or sequences containing t (instead of u) are not supported by the search engine!
 
  Privacy   Sitemap   Legal