miRCURY LNA™ microRNA Inhibitors and Power Inhibitors Reverse genetics with antisense inhibitors is one of the most powerful ways of understanding microRNA function. We have exploited our LNA™ technology even further to develop 2nd generation inhibitors that are truly unique in terms of potency, specificity and stability.
Niels M. Frandsen, Ph.D., Product Manager Back | |
|
- Pre-designed inhibitors for specific suppression of all microRNAs in miRBase and our proprietary miRPlus™ sequences
- Sophisticated and innovative design
- Unmatched high efficacy even for AT-rich microRNA targets
- High and uniform potency enables multiplexing at low concentrations with minimal risk of off-target effects
- Superior specificity and biological stability for long lasting antisense activity
- End-labeling option for easy control of transfection efficiency
|
 |
NEW powerful microRNA inhibitors The new generation of miRCURY LNA™ microRNA Inhibitors were developed using novel advanced design algorithms that identify the optimal combination of length, sequence and LNA™ positioning. This ensures that the inhibitors offer a high uniform potency combined with excellent specificity and biological stability, while keeping self-complementarity to a minimum.
The choice of three different product categories is offered:
- miRCURY LNA™ microRNA Inhibitors These are our well-known pre-designed microRNA inhibitors with a novel design. Using a new sophisticated design algorithm, the microRNA inhibitors have been optimized with respect to potency and stability.
- miRCURY LNA™ microRNA Power Inhibitors Power inhibitors is an entirely new product catagory with the highest potency on the market. These inhibitors come with a phosphorothioate (PS) backbone which makes them highly resistent to enzymatic degradation. As a result they have superior potency and prolonged stability. In all other respects this class of inhibitors is identical to our regular line of microRNA inhibitors.
- Custom miRCURY LNA™ microRNA Inhibitors If your choice of microRNA inhibitor is not available among the pre-desigend products, Exiqon will design it for you. Read more at Custom miRCURY LNA™ microRNA Inhibitors
Coverage and Content Pre-designed miRCURY LNA™ microRNA Inhibitors and Power Inhibitors are available for all known microRNAs in invertebrates, vertebrates and plants as registered and annotated in miRBase and for Exiqon's proprietary miRPlus™ microRNAs.
The miRCURY LNA™ microRNA Inhibitors are available with fluorescein (6-FAM) labels or as ready-to-label oligonucleotides. All microRNA inhibitors are HPLC-purified and desalted and delivered in tubes containing 5 nmol dried-down oligonucleotide ready for transfection or electroporation using standard techniques.
ApplicationOur miRCURY LNA™ microRNA Inhibitors are ideal for use as specific suppressors of microRNA activity. Other applications include identification and validation of microRNA targets, the study of microRNA function in cellular processes and pathological pathways, and microRNA regulation of gene expression. Since the LNA™-enhanced microRNA Inhibitors are Tm-normalized, they are ideal for use in multiplexing and screening assays.
The miRCURY LNA™ microRNA Power Inhibitors have phosphorothioate (PS) backbones that stabilize the inhibitor. We therefore recommend these inhibitors in difficult applications where: - the transfection efficiency is limiting (primary cells, cells growing in suspension)
- the microRNA target is highly expressed
- the phenotypic readout that takes place >72 h after transfection (cell differentiation)
- regular microRNA inhibitors fail
Note miRCURY LNA™ microRNA Inhibitor Negative Controls are also available.
To find a particular miRCURY LNA™ microRNA Inhibitor, please use the search function below.
|
|
Unmatched high and uniform potency The miRCURY LNA™ microRNA Inhibitors comprise the 2nd generation of Exiqon’s popular inhibitors. A novel and sophisticated design has been introduced giving both high and uniform potency (by taking advantage of the unprecedented properties of LNA™). In varying the number and positions of LNA™ bases in the inhibitors, the melting temperatures of the oligonucleotides has been normalized to an optimal temperature, while the level of self-complementarity is kept to a minimum. Besides increasing the efficacy of the inhibitors it also make them ideal for multiplexing assays.
These design features means that the inhibitors will have the same high efficacy towards all microRNAs regardless of the GC-content of the targeted microRNA. This is important because the GC-content of microRNAs varies between 5% - 95%. Since the binding affinity of traditional antisense inhibitors (2'-OMe oligonucleotides) is essentially dictated by the GC-content of their microRNA targets, they will typically have poor or no efficacy against AT-rich microRNA. The dramatic effect of intelligently placed LNA™ bases in the inhibitor oligonucleotide sequence to increase and normalize their Tm is shown in Figures 1-3.
Get even higher potency with Power inhibitors The miRCURY LNA™ microRNA Power Inhibitors come with complete phosphorothioate (PS) backbones, which results in higher potency and stability. As seen in Figure 4, the efficacy of these inhibitors is substantially improved compared to our regular inhibitors. Figure 5 shows an example of how our Power Inhibitors can be used.
Excellent specificityIntelligent LNA™-spiking also ensures excellent discrimination between closely related microRNA family members, which means that any biological effects seen with the inhibitors can be safely attributed to the antisense inhibition of the targeted microRNA and not to unspecific binding.
Minimal toxicity and off-target effectsThe high potency of both miRCURY LNA™ microRNA Inhibitors and Power Inhibitors means that they can be used at low concentrations minimizing risk of undesired secondary effects unrelated to the antisense activity.
An added benefit of having LNA™ bases distributed throughout the entire length of the oligonucleotide is that the LNA™ inhibitor/mRNA duplexes are not recognized as substrates for RNase H. As a consequence, there will be minimal off-target effects on mRNAs.
As an additional unique attribute, the miRCURY LNA™ microRNA Inhibitors and Power Inhibitors are HPLC purified to reduce potential issues of toxicity. |
|
Figure 1 Exiqon's microRNA inhibitors have high uniform potency. (Click to learn more)
Figure 2
Exiqon's microRNA inhibitors offer higher efficacy than leading competitors. (Click to learn more)
Figure 3 Silencing of common microRNAs. (Click to learn more)
Figure 4 Power inhibitors offer even higher potency. (Click to learn more)
Figure 5 Efficacy of the microRNA inhibitors. (Click to learn more)
|
|
|
|
|
|
|
Note: Due to cross-species conservation queries with a microRNA from a given species may give an inhibitor named for another species (typically hsa-mir-xxxx). To see all microRNAs targeted by the inhibitor click on the product and go to the “Targeted microRNAs” tab.
|
|
Search tips: Search for the miRNA by entering:- product number (426845-00)
- mature miRNA miRBase ID (hsa-mir-16)
- mature miRNA miRBase accession (MIMAT0000069)
- mature miRNA sequence (uagcagcacguaaauauuggcg)
If no results are returned please check that the entered information is accurate or entered in the correct field. If the problem persists please contact our technical support.
NB: Queries with stem-loop pre-miRNA miRBase accession (MI0000070) or sequences containing t (instead of u) are not supported by the search engine!
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|