Exiqon
Home Search Contact Print Sign In
 
 
Products Services Applications Resource Center Ordering About Exiqon Investor
microRNA Research
RNA Research
DNA Research
Custom Oligos
Other Reagents
RNA Isolation
Microarray Analysis
Real-time PCR
Northern Blotting
In Situ Hybridization
Functional Analysis
RNA Preparation
Microarray analysis
Real-time PCR
In Situ Hybridization
Antisense
SNP Detection
Microarray Analysis
In Situ Hybridization
LNA Phosphoramidites
A2 Quencher
RNA Isolation Services
microRNA Array Services
microRNA PCR Services
microRNA ISH Services
Custom Pharma Service
Isolation
Microarray Analysis
Northern Blotting
Real-time PCR
In Situ Hybridization
Functional Analysis
SNP Detection
RNA
microRNA
RNA
DNA
microRNA
microRNA
mRNA
microRNA
Other RNAs
DNA
microRNA
RNA
DNA
MicroRNA Research
RNA Research
Other reagents
Technology Base
Oligo design tools
Exiqon E-talk
MicroRNA
Research Guide
Array Data Analysis
qPCR Data Analysis
Tech notes and Manuals
Scientific Publications
Application Stories
Bioinformatics
Technical Literature and Manuals
Scientific Publications
Application Stories
Bioinformatics
Technical Literature and Manuals
Scientific Publications
Oligo modifications
LNA™
AQ-link
Order microRNA products
Order custom oligos
Distributors
General Information
Contact
Company profile
History
Management
Board of Directors
Awards & Partnerships
Sign up to Newsletter
Newsletter Back Issues
 

Design Custom miRCURY LNA™ Universal RT microRNA PCR Assays

Design custom LNA™-enhanced microRNA qPCR primer sets for any organism by following the two simple steps outlined below.

Before proceeding with the design, please make sure that pre-designed validated primers are not available for your microRNA: Search for pre-designed primer sets.

Step 1

  • Enter the target sequence of your small RNA (e.g. uagcuuaucagacugauguuga)
  • Enter a name for your qPCR primer set
  • Select the organism of origin for your target sequence
  • Press the 'Design assay' button. Note, the design process may take several minutes.

Step 2

  • Select one or more primer sets from the list of designs.
  • Press 'Add to basket' to proceed with your order.
  • Press the 'View basket' button to view product details and to proceed to check-out.

Additional products

The LNA™ primer sets designed using this software are optimized for use with the following products:
microRNA qPCR designer
Errors
Warnings
Press design button again.
qPCR primer set name Organism  
   
Homo sapiens
    
 
miRNA sequence (5'-3')       The submitted sequences will be stored in Exiqon IT systems but will not be disclosed to any third party.
The average design time for a 22mer target is 90 seconds. For longer sequences the design process may take up to 5 minutes.
 
 


NOTICE TO PURCHASER: LIMITED LICENSE Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US: 5,994,056 and 6,171,785. The purchase of this product includes a limited, nontransferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser's own internal research. No right under any other patent claim and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA.
  Privacy   Sitemap   Legal